Air frying pork loin chops12/8/2023 After 6 minutes of cooking, flip the pork chops and then continue cooking for the remainder of time or until golden and internal temperature reaches 145-160☏. Powered by the ESHA Research Database © 2018, ESHA Research, Inc. Crispy recipe for crispy crusted pork chops in air fryer is less and 30 minute easy dinner Crispy Air Fryer Breaded Pork Chops Recipe easy. For extra flavor, change up the pork chop seasoning Use your favorite seasoning mix, like McCormick's, or seasoning rub or try sprinkling with Italian seasoning, grated parmesan cheese, or coat with panko breadcrumbs before air frying. Rinse and completely dry the pork chops with a clean tea towel or paper towel. Casserole Use BBQ sauce for coating, or your favorite dipping sauce of choice. If you are following a special diet for medical reasons, be sure to consult with your primary care provider or a registered dietitian to better understand your personal nutrition needs. Instructions: Heat the air fryer to 200C for 5 minutes. (-) Information is not currently available for this nutrient. Cook in an air fryer at 375 degrees F (190 degrees C) until lightly browned, 8 to 10 minutes. Place in the air fryer basket and spritz with avocado oil. Dip each pork chop in egg, then in Parmesan-flour mixture to coat. (For example, it’s recommended that people following a heart-healthy diet eat less sodium on a daily basis compared to those following a standard diet.) Mix Parmesan cheese, almond flour, 1/2 teaspoon salt, 1/4 teaspoon pepper, and garlic powder together in a second bowl. Depending on your calorie needs or if you have a health condition, you may need more or less of particular nutrients. Per the Food and Drug Administration (FDA), the daily value is based on a standard 2,000 calorie diet. Percent Daily Value (%DV) found on nutrition labels tells you how much a serving of a particular food or recipe contributes to each of those total recommended amounts. * Daily Values (DVs) are the recommended amounts of nutrients to consume each day. Nutrition information is calculated by a registered dietitian using an ingredient database but should be considered an estimate.
0 Comments
Icarus wiki12/8/2023 ĭaedalus gave his name, eponymously, to many Greek craftsmen and many Greek contraptions and inventions that represented dextrous skill. In fact, so many other statues and artworks are attributed to Daedalus by Pausanias and various other sources that likely many of them were never made by him. Pausanias, in traveling around Greece, attributed to Daedalus numerous archaic wooden cult figures (see xoana) that impressed him. He is also said to have carved statues so spirited they appeared to be living and moving. Supposedly, he first invented masts and sails for ships for the navy of King Minos. In Pliny's Natural History (7.198) he is credited with inventing carpentry, including tools like the axe, saw, glue, and more. Eleftherna, archaic period, 7th century BC.ĭaedalus is not mentioned again in literature until the fifth century BC, but he is widely praised as an inventor, artist, and architect, though classical sources disagree on which inventions exactly are attributable to him. Upper body of a Daedalic statue of a Kore, poros stone. Rather, Homer was referencing mythology that his audience was already familiar with. It is clear that Daedalus was not an original character of Homer's. He is later mentioned by Homer as the creator of a dancing floor for Ariadne, similar to that which Hephaestus placed on the Shield of Achilles. Inventor, architect, artist ĭaedalus is first mentioned in roughly 1400 BC on the Knossian Linear B tablets. The Athenians made Cretan-born Daedalus Athenian-born, the grandson of the ancient king Erechtheus, claiming that Daedalus fled to Crete after killing his nephew. Daedalus had two sons: Icarus and Iapyx, along with a nephew named either Talos, Calos, or Perdix. Similarly, his mother was either Alcippe, Iphinoe, Phrasmede or Merope, daughter of King Erechtheus. His father is claimed to be either Eupalamus, Metion, or Palamaon. Family ĭaedalus's parentage was supplied as a later addition, with various authors attributing different parents to him. The name appears in the form da-da-re-jo-de, possibly referring to a sanctuary. The name Daidalos seems to be attested in Linear B, a writing system used to record Mycenaean Greek. It was during this escape that Icarus did not heed his father's warnings and flew too close to the sun the wax holding his wings together melted and Icarus fell to his death. Among his most famous creations are the wooden cow for Pasiphaë, the Labyrinth for King Minos of Crete which imprisoned the Minotaur, and wings that he and his son Icarus used to attempt to escape Crete. He is the father of Icarus, the uncle of Perdix, and possibly also the father of Iapyx. In Greek mythology, Daedalus ( UK: / ˈ d iː d ə l ə s/, US: / ˈ d ɛ d ə l ə s/ Greek: Δαίδαλος Latin: Daedalus Etruscan: Taitale) was a skillful architect and craftsman, seen as a symbol of wisdom, knowledge and power. The old language eggs (discord-js-generic, discord-py-generic, etc) have been moved to the generic languages section.A Roman mosaic from Zeugma, Commagene (now in the Zeugma Mosaic Museum) depicting Daedalus and his son Icarus Note: these are actual Discord bot eggs, NOT language eggs. This is not required on 1.X Please read the CONTRIBUTING.md before submitting PRs Bots You must restart your daemon after importing an egg if you are using 0.7. If you want a new nest you need to create it before importing the egg.
Cannot access google chrome extensions12/7/2023 The app ID uniquely identifies the app in the Admin console, on users' devices, and in Chrome Web Store.ĭisplays how the app or extension is installed for users. For self-hosted apps, the name and ID are the same. Chrome-For apps that are hosted in the Chrome Web Store, the unique ID is 32 characters long.The ID uniquely identifies the app in the Admin console, on users' devices, and in Google Play. Android-The Android app's unique app ID that looks like a Java package name, such as.The ID format depends on app or extension type: On the Apps & extensions page, you can see the following details for each of your apps and extensions. Under Installation policy, choose Block.Find and click the app that you want to remove.Click Apps & extensions Users & browsers.If you're adding by URL, enter the URL of the progressive web app for users or a shortcut to a website, choose how you want the website to display, and click Save.If the extension is outside of the Chrome Web Store, enter the ID, select From a custom URL, enter the URL, and click Save. If you're adding by ID, enter the ID and click Save.If prompted, accept the app permissions on behalf of your organization. If you're adding an app from the Chrome Web Store or Google Play, find the app and click Select.Add by URL (available for Users & browsers only).To add a free app, click Add and choose an option:.Note: This option is not available for Google Workspace for Education Fundamentals customers. To add a Chrome Web Store app that costs money, click Add and choose Add Chrome app or extension by ID.Click the type of app or extension you want to add:.Set the app and extension policies you want to change.Find and click the app you want to manage.Otherwise, select a child organizational unit. To apply the setting to everyone, leave the top organizational unit selected.Select the group to which you want to apply the setting.(Users only) To apply the setting to a group, do the following:.Managed guest sessions-Configure the app for users who sign in to a managed guest session on a managed ChromeOS device.For information about turning ChromeOS devices into single-purpose devices, see Create and deploy Chrome kiosk apps. Kiosks-Deploy the app to a managed ChromeOS device as a kiosk app if the app is kiosk-enabled in the app’s manifest file.You can also configure the app for a specific organizational unit or group. Users & browsers-Configure the app for users who sign in with a managed Google Account on any device, and for enrolled browsers.Click the type of app or extension you want to configure:.Open all | Close all Set policies for an app (main steps)įrom the Admin console Home page, go to Devices Chrome. For details, see Understand when settings apply. Make app management settingsĬan apply for signed-in users on any device or enrolled browsers on Windows, Mac, or Linux. For details, see Control access to sensitive data with security groups. You might also need to consider if a user belongs to a security group. For details, see Understand Chrome policy management. This does not affect the policy precedence as set by the CloudPolicyOverridesPlatformPolicy and CloudUserPolicyOverridesCloudMachinePolicy policies. Note: If a user belongs to both a group and an organizational unit where app and extension policies are set, the policies set for groups take precedence over those set for organizational units. There is a limit of 500 for the total number of apps times the number of groups.For details about how to turn services on or off for users, go to Additional Google services. To let users manually download apps or extensions, you need to turn on Chrome Web Store or Google Play. Even if Chrome Web Store or Google Play are turned off, apps and extensions that you set to Force-install or Force-install + pin automatically download.If you allowlist Android apps, users can’t switch to secondary accounts in Google Play.To apply settings for Chrome browser users on Windows, Mac, or Linux computers, turn on Chrome management for the organizational unit that they belong to.For details, see Groups and Add an organizational unit. Only user accounts can be added to groups. To make settings for a specific group of users or enrolled Chrome browsers, put the user accounts or browsers in a group or organizational unit.For example, you might force-install an app and pin it to users' Chrome taskbar. For administrators who manage Chrome policies from the Google Admin console.Īs a Chrome Enterprise admin, you can use your Admin console to set policies for a specific web app, Chrome app or extension, or supported Android app. Html symbols shapes geometric12/7/2023 The draggable control nubs transform the Shape by moving the corners of the Shape's bounding box. Click and drag the nubs to relocate them. The shape will be created in Edit mode. In Edit mode, the shape is not fixed and can be altered in size, orientation, fill and color along with antialiasing options and blend modes.Īll these options are available from the Tool Bar when the Shapes Tool is active. Click the Finish button in the Tool Bar to commit the To create a shape, click on the shape type in the Tool Bar menu and drag the shape out on the canvas. Pressing A cycles through the shapes when the Shapes tool is active ( Shift + A cycles backwards ).
Airflow 2.0 tutorial12/7/2023 Starting with Airflow 2.3.0, Airflow is tested with Python 3. Note Successful installation requires a Python 3 environment. """ # Tutorial Documentation Documentation that goes along with the Airflow tutorial located () """ # from datetime import timedelta from textwrap import dedent # The DAG object we'll need this to instantiate a DAG from airflow import DAG # Operators we need this to operate! from import BashOperator from airflow.utils. This quick start guide will help you bootstrap an Airflow standalone instance on your local machine. See the License for the # specific language governing permissions and limitations # under the License. You may obtain a copy of the License at # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License") you may not use this file except in compliance # with the License. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. See the NOTICE file distributed with this work for additional information regarding copyright ownership. Which are used to populate the run schedule with task instances from this dag.# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. Source code for Licensed to the Apache Software Foundation (ASF) under one or more contributor license agreements. The date range in this context is a start_date and optionally an end_date, The Airflow Stable REST API documentation is located here. To also wait for all task instances immediately downstream of the previous The maindev.py and mainprod.py scripts will demonstrate how to use the Airflow 2.0 Stable REST API via the python requests library. Of its previous task_instance, wait_for_downstream=True will cause a task instance For example, if you want to display DAG then you can use the following command: Some Airflow commands like states-for-dag-run. While depends_on_past=True causes a task instance to depend on the success When using bash (or ) as your shell,, add the following to your. You may also want to consider wait_for_downstream=True when using depends_on_past=True. Will disregard this dependency because there would be no Task instances with execution_date=start_date Will depend on the success of their previous task instance (that is, previousĪccording to execution_date). Note that if you use depends_on_past=True, individual task instances This article will go through some of the new features of Airflow 2.0 ( Python 3.5+) and how we can utilize these new features to build highly available, scalable, and efficient solutions. airflow webserver will start a web server if youĪre interested in tracking the progress visually as your backfill progresses. If you do have a webserver up, you will be able From datetime import timedelta from textwrap import dedent # The DAG object we'll need this to instantiate a DAG from airflow import DAG # Operators we need this to operate! from import BashOperator from import days_ago # These args will get passed on to each operator # You can override them on a per-task basis during operator initialization default_args =, ) t1 > Įverything looks like it's running fine so let's run a backfill.īackfill will respect your dependencies, emit logs into files and talk to Cerave tinted sunscreen with spf12/7/2023 This is why using products with either hyaluronic acid or sodium hyaluronate - like CeraVe Tinted Sunscreen - can help to improve skin hydration.Įmollients: Create a Silky, Smooth Skin Feel In fact, hyaluronic acid is able to hold more water than any other natural substance-up to 1,000 times its weight in water! Hyaluronic acid is a glycosaminoglycan (GAG), a long polysaccharide (sugar molecule) that’s able to absorb and hold a large amount of water. Once applied to the skin, sodium hyaluronate provides the same benefits of hyaluronic acid. That’s why it is common to see sodium hyaluronate on an ingredient list even though the product name might say hyaluronic acid. The main differences are that sodium hyaluronate is more stable, easier to formulate, and cheaper. Sodium hyaluronate and hyaluronic acid are basically the same, and the two names are used interchangeably in the skin care industry. Sodium Hyaluronate: The Salt Form of The Moisture Magnet Hyaluronic AcidĬeraVe Tinted Sunscreen includes sodium hyaluronate, the sodium salt form of hyaluronic acid. Here’s why we love niacinamide: A publication in the Journal of Clinical and Aesthetic Dermatology, states that niacinamide can repair the skin barrier and improve skin moisture, as well as reduce inflammation, blotchiness, hyperpigmentation, acne, and wrinkling. We love that CeraVe Tinted Sunscreen contains a decent amount of niacinamide, which is one of the best skin care ingredients, in our opinion. That’s why applying products that contain ceramides - such as CeraVe Tinted Sunscreen - can help to replenish ceramide levels, thus restoring the skin’s natural barrier. The result is skin that can easily become dry, itchy, or irritated. Without ceramides, the skin barrier is weakened, just like without mortar a brick wall would be weak and unstable. The corneocytes (dead skin cells) that make up the cell envelope are layers, like bricks, mortared together by lipids (ceramides), that create the outer water barrier.Ī properly functioning stratum corneum is essential for healthy skin as it maintains epidermal hydration and serves as a barrier that responds to environmental stressors, infections, irritants, and allergens. But what exactly are ceramides and how can they benefit your skin?Ĭeramides are a family of waxy lipid molecules that are naturally produced by the skin and are vital in supporting the stratum corneum (the outer layer of skin).Īccording to Healthline, the stratum corneum is sometimes described as a brick wall. That’s the reason CeraVe added a tint to this product the tint allows the formula to seamlessly blend into most skin tones to offset any whitening effect of the mineral sunscreen ingredients.Īll CeraVe skin care products - including CeraVe Tinted Sunscreen - contain essential ceramides. However, physical sunscreens are thicker than chemical sunscreens and can often leave a white cast after application. rosacea patients) as well as those with acne-prone skin as they are typically less pore-clogging. Thus, they are especially useful for those with heat sensitive skin (i.e. Physical sunscreens tend to be better tolerated by most skin types because they are not absorbed into the skin. There are two mineral sunscreen ingredients in CeraVe Tinted Sunscreen: zinc oxide and titanium dioxide.Īlso known as physical sunscreens, these ingredients protect your skin by using physical UV filters to block or deflect UV light. Mineral Sunscreens: Create a Protective Film to Reflect UVA/UVB Rays In order to determine how well CeraVe Tinted Sunscreen performs, we’ll have to evaluate the key ingredients in this formula. What are the Best Skin Care Products of 2023? What Are The Key Ingredients in CeraVe Tinted Sunscreen? Cost? Depends where you purchase $16.99 USD for 1.7 oz on.Skin type? Recommended for all skin types (including sensitive skin and acne-prone skin).Key ingredients? Mineral sunscreens (zinc oxide and titanium dioxide), ceramides, niacinamide, sodium hyaluronate. Is CeraVe Tinted Sunscreen Right For You?īefore we get into the details, here’s the TL DR if you just want to know whether or not CeraVe Tinted Sunscreen is right for you. We’ll also share some reviews so that you can get an idea of what customers really think of this CeraVe sunscreen. Plus, the formula contains supporting key ingredients - like ceramides, niacinamide, and sodium hyaluronate - to strengthen the skin barrier and retain moisture.īelow we’ll give you all the details on CeraVe Tinted Sunscreen, including the key ingredients in the formula and the research that supports (or doesn’t support) their use in skin care. CeraVe Tinted Sunscreen is a 100% mineral sunscreen that provides broad spectrum SPF 30 protection while also creating a healthy glow thanks to a universal tint. Serial cloner online12/7/2023 I liked it so much I donated to SerialBasics. Don't hesitate to get Carbon Copy Cloner if you are in need of a backup solution for your Mac - you won't regret the decision. SerialCloner has a in silico PCR tool, and is also great for cloning, RE maps, etcetera. Please visit the main page of Serial Cloner on Software Informer. Ultimately, he was able to identify the problem as being due to runaway crash reports from a faulty piece of software, and walk me through the steps necessary to get rid of the issue and assure a clean backup, and to give me some advice on next steps to deal with the disc replacement process. Download popular programs, drivers and latest updates easily. Over the course of three days, I exchanged a number of emails with Mike Bombich, who got back to me with analysis of my CCC log files within a few hours each time. To Install Serial Cloner (Mac and Windows): When using the archive, download the file (Disk image for MacOSX or compressed Zipped file For Window, un-compress it and copy the resulting Serial Cloner Folder in your Application folder. But the thing that really makes me sing Bombich's praises is the quality of its customer support. used auto key programmer, used transponder key cloner, used diagnostic scanners. Serial Cloner is freeware and is available for MacOSX, Windows and Linux Features ReadMe 2-1. 5m) 9-pin serial cable for easy connection to your computer. Imported File Types SeqNinja Feature Table Files (.starff) Sequencher 4.2 Assembly Projects (.spf) Serial Cloner (.xdna) SnapGene (.dna. :: DESCRIPTION Serial Cloner has been developed to provide a light molecular biology software to both Macintosh and Windows users. It provides tools with an intuitive interface that assists you in DNA cloning, sequence analysis and visualization. The documentation is a model of clarity, and serves as an educational repository and resource on the philosophy of backup strategies that greatly enhances one's understanding of the product and its use. Serial Cloner is a Molecular Biology software. Comment choisir les amorces et réaliser la PCR sur le logiciel de biologie moléculaire Serial ClonerMa vidéo explicative sur le choix des amorces de PCR: htt. It does the job of providing a robust backup solution for your Mac in a clean, elegant manner. AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCIGGCACGACAGGITTCC CGACIGGAAAGCGGGCAGTGAGCGCMACGCAATTAATGEGAGTTAGCTCACTCATTAGGCACCCCAGGCITTA CACTITATGCITCCGGCTCGTATGTTGTGTGGAR AGCGGATAACAATTTCACACAGGNANCAGCTATG ACCATGATTACGCCAAGCTATTTAGGEGACACT GAATACTCAAGCTATGCATCAAGCTTGGTACCGAGCT CGGATCCACTAGTAACGOC GTGCTGG CAGATATCC CACACTGGCGGCCGCTCGNGCA TGCATCEAGAGGGOCCAATTCGCCCTATAG GAGTCGTATTACAATTCACIGGCCGTCGETTTACAACGTCGT GACTGGGAAAACCCTGGCGT TTAAT cccc GCTGGCGTAATA GCGAAGAGGCCCGCACCGATCGCCCIICCCAAC GCGCAGCCTATACGTACGGCAGITTMAGGTTTACAC CTATAMAAGAGAGAGCCGTT.I can't say enough good things about Bombich Software's Carbon Copy Cloner. Remember the more facts you can discern from the sequence the more points you get. Serial Cloner also import files saved in the Vector NTI, ApE, pDRAW32 and GenBank formats. This package was approved by moderator mwallner on. Serial Cloner reads and write DNA Strider-compatible files and import and export files in the universal FASTA format. For example, your sequence analysis can contain the location of enzyme digestion sites, the number and size of any open reading frames, the identity of any sequence elements and genes and possibly a map of the DNA with the sequence elements identified. :: DESCRIPTION Serial Cloner has been developed to provide a light molecular biology software to both Macintosh and Windows users. Points will be awarded based on how extensive your interpretation is. Characterize the sequence using Serial Cloner or any other sequence analysis software you chose. My time at sandrock beta key12/7/2023 My Time at Sandrock features a dynamic combat system and new weapons that you can use to defeat your enemies by landing critical hits after breaking their defense. There are dangers in Sandrock and the surrounding area too, and you will have to be prepared to engage some enemies in combat. My Time at Sandrock features a dynamic combat system and new weapons that you can use to defeat your enemies by landing critical hits after breaking their defense. My Time at Sandrock PC My Time at Sandrock PC Platform Edition Reviewed 100 12.79 32. Learn their stories and complete missions for them, and you will gain experience and level up to unlock bonuses. Sandrock is your new home, and you will meet plenty of people that you can help as you explore the city. Currently, the game’s storyline is only one-third completed and the developers will be. Created by Pathea Games 9,915 backers pledged 524,770 to help bring this project to life. Our team has incorporated numerous changes into. My Time at Sandrock will likely be in early access until 2023 or later depending on how development goes. Collaborate on creating construction projects, engage in battles, and witness the dynamic transformation of the desert town. Our development team invites you to participate in this co-op adventure as you team up with your friends or new buddies online. But before that, you will have to explore the surrounding area and gather all kinds of useful items and resources that you can use in your workshop. Howdy Builders, Welcome to the Multiplayer Open Beta Test, available for everyone until Launch. The keys cannot currently be rebound key rebinding will be added later, I believe. The basic controls are as follows, and there are prompts on the screen to help you remember. You will have pro process raw materials with the machines you build in order to use them for other projects. The demo does not support controllers, so you can do some things, but for other things youll need to default to the keyboard + mouse. This patch upgraded many UIs and UXs, which may help your Sandrock journey move smoother. Use different blueprints and materials to help rebuild the city of Sandrock and make it flourish. Howdy Beta players, We just released a new update to beta players. You will start by building a workshop that you can use to create everything you need. Sandrocks Beta Access Keys have been sent out to Kickstarter Backers. Gather, build, and craft in My Time at Sandrock, a new sandbox life simulator that puts you in the shoes of a builder. The fans of My Time at Portia will love a new opportunity to embark on an adventure in the post-apocalyptic world void of most modern technology. My Time at Sandrock Steam SteamDB Steamcharts PCGamingWiki Github Issue Search Natively Supports: Show Minimum Requirements RPG Post-apocalyptic Character Customization Farming Sim Deck Verified Status Worked right out of the box. Dynamic polymorphism java example12/7/2023 There are four main and three secondary principles of object-oriented Java programming. Java in particular enforces OOP, which creates good habits (but may be challenging for beginners).Teams working from the same code base will benefit from existing well-written classes.Make large and complex code bases more efficient and manageable.Classes provide easy “building blocks” for faster coding and make code highly maintainable.They make it possible to reuse code without creating security risks or harming performance and code readability. In Java, OOP concepts allow us to create specific interactions between Java objects. Java supports object-oriented programming, along with other popular languages like Python and C++. This works particularly well for large team projects where states change often. Using OOP, programmers can create classes in order to iteratively reuse code, with the same set of “instructions” being sent to different objects, rather than coding each operation from scratch each time. Object-oriented programming focuses on objects made up of both data (fields) and code (properties or attributes). In this guide, we’ll look into both the theory and practice of object-oriented programming to help you write performant and error-free Java code. While these concepts are crucial for creating well-structured Java programs in the development phase, implementing crash reporting can also help you catch the errors your end-users encounter in the operation and maintenance phase of the software development life cycle. Java comes with specific code structures for each OOP concept, such as the extends keyword for the inheritance principle or the getter and setter methods for the encapsulation principle. There are seven core principles of object-oriented programming, as follows. OOP concepts are intended to improve code readability and reusability by defining how to structure your Java program efficiently. Java is a class-based object-oriented programming (OOP) language built around the concept of objects. Using OOP concepts to write high-performance Java code (2023) By Anna Monus | Posted | 14 min. Analog efex pro key12/6/2023 I’ve blown the panel up in this and subsequent screenshots to make the controls easier to see. The default conversion looks pretty plain, dull even. I’ve opened it in Color Efex Pro with no filter applied, and highlighted the B/W Conversion filter in the left sidebar. This is my start shot, a seaside scene in late afternoon with a rich, blue sky. You can add the Levels & Curves filter for a little dodging and burning, the Film Grain filter for a textured analog look or the Paper Toner filter for a toning effect.īut let’s just see what the B/W Conversion filter can do on its own first. Perhaps the key thing is that this filter needn’t be used on its own. It offers three different conversion modes, with the ability to apply a black and white ‘contrast’ filter in each to change the tonal rendition, and other controls for perfecting your black and white shots. Now you might think that the Nik Collection has other, better tools for black and white, like Silver Efex Pro and Analog Efex Pro.īut the B/W Conversion filter has a few surprises of its own. One of these is the B/W Conversion filter, right at the top of the list in the left sidebar. Not all of these filters are equally useful, I’ll admit, but many are very good indeed, with unexpectedly deep controls and features. It has no fewer than 54 different filters, all of which can be used on their own or in combination with others in ‘Recipes’. Color Efex Pro, part of the DxO Nik Collection is practically an application in itself. AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |